Gene name |
SPAC926.08c |
Gene ID |
17/C12 |
Gene synonyms/obsolete |
|
Gene product |
RNA-binding protein;
Brix domain; involved in RNA processing; involved in ribosome
biogenesis and assembly; eukaryotic conserved protein |
Entry clone |
Cloned# |
ORF length (unspliced) |
1104 |
ORF length (spliced) |
954 |
Entry clone length |
1104 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC926.08.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTTCGTCAAGTGTAAGA |
Rev primer name |
SPAC926.08.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTCGCTAGCATCTGAAATG |
Amino acid length |
317 |
Molecular weight |
36 |
Isoelectric point (calc.) |
9.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleolus>nucleus>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |