Gene name |
SPAC26H5.09c |
Gene ID |
17/D12 |
Gene synonyms/obsolete |
|
Gene product |
oxidoreductase;
GFO_IDH_MocA family; similar to Sp SPBC115.03 (paralog) |
Entry clone |
Cloned |
ORF length (unspliced) |
1110 |
ORF length (spliced) |
|
Entry clone length |
1110 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
484T:C / 887T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC26H5.09.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCGCCTATTAAAACTGC |
Rev primer name |
SPAC26H5.09.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTCGGACAATGGGATGGAA |
Amino acid length |
369 |
Molecular weight |
41.4 |
Isoelectric point (calc.) |
6.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus |
Comments for localization |
spindle microtubules
by over expression? |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |