| Gene name |
SPCC1223.11 |
| Gene ID |
17/E08 |
| Gene synonyms/obsolete |
ptc2 |
| Gene product |
serine/threonine
protein phosphatase; involved in regulation of osmolarity;
protein phosphatase 2C family involved in mRNA splicing
(implicated); similar to Sp ptc3 (paralog) |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
1113 |
| ORF length (spliced) |
|
| Entry clone length |
1113 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
323T:A |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC1223.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGCCAAACACTCTCAGA |
| Rev primer name |
SPCC1223.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATGAAGGTAATAGCGATCG |
| Amino acid length |
370 |
| Molecular weight |
40.8 |
| Isoelectric point (calc.) |
4.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>=cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |