| Gene name |
SPBC4C3.08 |
| Gene ID |
17/F04 |
| Gene synonyms/obsolete |
B20341-2 |
| Gene product |
acetylglucosaminyltransferase; galactosyltransferase
family 8; predicted N-terminal signal sequence; tandem
duplication; similar to S. pombe SPBC4C3.09 and SPAC5H120.02;
similar to S. cerevisiae YOR320C |
| Entry clone |
Cloned in 2004
trial_also cloned#/ 3' FS at 1st |
| ORF length (unspliced) |
1119 |
| ORF length (spliced) |
|
| Entry clone length |
1119 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC4C3.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGTTTATATTTTAGTGC |
| Rev primer name |
SPBC4C3.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATATAAATCAGCATTACGT |
| Amino acid length |
372 |
| Molecular weight |
43.7 |
| Isoelectric point (calc.) |
7.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGLCLLITLSI |
| Localization (YFP) |
ER?; cytoplasmic dots;
Golgi? |
| Comments for localization |
ER-Golgi? |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |