| Gene name |
SPCC736.04c |
| Gene ID |
17/G02 |
| Gene synonyms/obsolete |
gma12 |
| Gene product |
alpha-1,2-galactosyltransferase Gma12;
non-essential; GMA12/MNN10 family; predicted N-terminal signal
sequence; Involved in the O- and N-linked oligosaccharide
modification of proteins transported through the Golgi stack;
This occurs in cis Golgi where the enzyme transfers galactose
from UDP- galactose to a variety of mannose based acceptors;
Ptm O-glycosylated; Belongs to the glycosyltransferase 34
family; similar to S. pombe gmh1 and gmh2 and gmh3 and
SPBC1289.13C and SPAC5H10.13C and SPAC637.06 and
SPBC8D2.17 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1128 |
| ORF length (spliced) |
|
| Entry clone length |
1128 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
678A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC736.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGGTTCGCTCCTTATTT |
| Rev primer name |
SPCC736.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGGATGATGGTTTCAAAAGA |
| Amino acid length |
375 |
| Molecular weight |
42.6 |
| Isoelectric point (calc.) |
6.1 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
Golgi |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |