| Gene name |
SPBC31E1.04 |
| Gene ID |
17/H12 |
| Gene synonyms/obsolete |
pep12 |
| Gene product |
SNARE predicted; Has a
role in vesicle-mediated transport but not with protein
transport from Golgi to vesiscle; Belongs to the
syntaxin/epimorphin family; Contains 1 t-SNARE coiled-coil
homology domain; similar to S. cerevisiae YOR036W |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1138 |
| ORF length (spliced) |
954 |
| Entry clone length |
1138 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
246A:G / 602T:deletion
/ 603T:deletion |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC31E1.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTTTTGTTGACTTGGA |
| Rev primer name |
SPBC31E1.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGTAAAGAAATAATCTGTA |
| Amino acid length |
317 |
| Molecular weight |
36.2 |
| Isoelectric point (calc.) |
8.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal
|