Gene name |
SPBC428.02c |
Gene ID |
18/A10 |
Gene synonyms/obsolete |
eca39;
SPBC582.12c |
Gene product |
branched chain amino
acid aminotransferase; phosphate dependent; involved in
leucine biosynthesis; involved in valine biosynthesis;
involved in isoleucine biosynthesis; non-essential |
Entry clone |
Cloned |
ORF length (unspliced) |
1143 |
ORF length (spliced) |
|
Entry clone length |
1143 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC428.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTTCAAACTGCTGCTCT |
Rev primer name |
SPBC428.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGGCAAAGCAGGAACGCTC |
Amino acid length |
380 |
Molecular weight |
42.5 |
Isoelectric point (calc.) |
7.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol=nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal
|