| Gene name |
SPCC11E10.02c |
| Gene ID |
18/A12 |
| Gene synonyms/obsolete |
gpi8 |
| Gene product |
GPI-anchor
transamidase activity; GPI-anchor transamidase complex;
peptidase family C13; essential; involved in GPI anchor
biosynthesis; involved in attachment of GPI anchor to protein
(required); functionally complements S. cerevisiae
GPI8 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1143 |
| ORF length (spliced) |
|
| Entry clone length |
1143 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC11E10.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATTGTTCAGTTTGTGGC |
| Rev primer name |
SPCC11E10.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTCAGGTACTTACTGGCA |
| Amino acid length |
380 |
| Molecular weight |
43.2 |
| Isoelectric point (calc.) |
5.8 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLLLNLLQI |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal
|