Gene name |
SPBC30B4.09c |
Gene ID |
18/B07 |
Gene synonyms/obsolete |
SPBC27B12.01c;
SPBC30B4.09a |
Gene product |
mitochondrial outer
membrane protein; involved in mitochondrial biogenesis;
involved in coupling mitochondria to the actin cytoskeleton
|
Entry clone |
Cloned |
ORF length (unspliced) |
1149 |
ORF length (spliced) |
1041 |
Entry clone length |
1149 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC30B4.09a.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATACACCTGCCGCAGGG |
Rev primer name |
SPBC30B4.09a.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATCTTCATTAGATGACTCC |
Amino acid length |
346 |
Molecular weight |
38.8 |
Isoelectric point (calc.) |
8.3 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
ER; cytoplasmic
dots |
Comments for localization |
aggregates by over
expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |