| Gene name |
SPCC613.08 |
| Gene ID |
18/C01 |
| Gene synonyms/obsolete |
|
| Gene product |
cdk inhibitor; similar
to human tok1 a p21Cip1-binding protein that cooperatively
enhances p21-dependent; inhibitory activity toward CDK2
kinase |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1153 |
| ORF length (spliced) |
978 |
| Entry clone length |
1153 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
975A:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC613.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTGTCCTTTATTTAAAAC |
| Rev primer name |
SPCC613.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGCGCTGTAAATTTCCATC |
| Amino acid length |
325 |
| Molecular weight |
37.4 |
| Isoelectric point (calc.) |
4.6 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSALADLIL |
| Localization (YFP) |
nucleus; ER?; nuclear
envelope? |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal
|