| Gene name |
SPAC3H8.10 |
| Gene ID |
18/E01 |
| Gene synonyms/obsolete |
spo20; sec14 |
| Gene product |
CRAL/TRIO domain;
required for transport of secretory proteins from the Golgi
complex; Catalyzes the transfer of phosphatidylinositol and
phosphatidylcholine between membranes in vitro; essential for
viability and secretion;has a direct role in controlling cell
septation and in forespore membrane formation |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1168 |
| ORF length (spliced) |
861 |
| Entry clone length |
1168 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC3H8.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCAGAAACTATATCGGA |
| Rev primer name |
SPAC3H8.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTTTTGTTCATCCACTGT |
| Amino acid length |
286 |
| Molecular weight |
32.7 |
| Isoelectric point (calc.) |
7.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
periphery |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal
|