Gene name |
SPAC27E2.07 |
Gene ID |
18/E06 |
Gene synonyms/obsolete |
|
Gene product |
glycosyltransferase;
involved in cell wall biosynthesis; deletion mutant
galactomannans deficient for pyruvylated
galactose-beta-1,3-galactose-alpha-1,2-pyruvylgalactose
(PvGal) (pers. comm. Robert Trimble); no apparent
orthologs |
Entry clone |
Cloned |
ORF length (unspliced) |
1170 |
ORF length (spliced) |
|
Entry clone length |
1170 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC27E2.07.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTAAACTCTGGGTAAA |
Rev primer name |
SPAC27E2.07.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGCAGTTATCAAGTCGAAT |
Amino acid length |
389 |
Molecular weight |
45 |
Isoelectric point (calc.) |
5.6 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol=nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal
|