| Gene name |
SPBC1773.08c |
| Gene ID |
18/F07 |
| Gene synonyms/obsolete |
|
| Gene product |
mannosyltransferase
complex subunit predicted; glycosyl transferase family;
conserved fungal protein; similar to S. pombe SPBC32H8.08c;
similar to S. cerevisiae YNL029C and YIL085C |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1176 |
| ORF length (spliced) |
|
| Entry clone length |
1176 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC1773.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGATACAAACAACTAAT |
| Rev primer name |
SPBC1773.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTCATCTAAGAATCCATCA |
| Amino acid length |
391 |
| Molecular weight |
45.4 |
| Isoelectric point (calc.) |
5.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal
|