| Gene name |
SPCC1753.03c |
| Gene ID |
18/G05 |
| Gene synonyms/obsolete |
rec7 |
| Gene product |
involved in meiotic
recombination (required); transcription meiotically induced;
involved in early meiotic recombination events; deletion
mutant results in frequent occurrence of two-spored asci;
deletion mutant results in frequent nondisjunction of
homologous chromosomes at the first meiotic division; opposite
strand transcripts detected |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1182 |
| ORF length (spliced) |
1020 |
| Entry clone length |
1182 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
986A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC1753.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAACATTTTCCCAATTGT |
| Rev primer name |
SPCC1753.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACATCTTGTTCCATACCCGT |
| Amino acid length |
339 |
| Molecular weight |
38.2 |
| Isoelectric point (calc.) |
8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LIQSINLLDL |
| Localization (YFP) |
nuclear dots;
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |