Gene name |
SPAC23H3.05c |
Gene ID |
19/B03 |
Gene synonyms/obsolete |
|
Gene product |
SET1 complex (TAP); WD
repeat protein; involved in transcriptional silencing;
involved in regulation of chromatin remodelling; similar to
retinoblastoma binding proteins; non-essential; involved in H3
K4 methylation (required) |
Entry clone |
Cloned |
ORF length (unspliced) |
1197 |
ORF length (spliced) |
|
Entry clone length |
1197 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
210A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC23H3.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAACTTGGAATTACTTGA |
Rev primer name |
SPAC23H3.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGAGGAACTAAGTGTAGGT |
Amino acid length |
398 |
Molecular weight |
45.1 |
Isoelectric point (calc.) |
4.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal
|