Gene name |
SPAC343.12 |
Gene ID |
19/C06 |
Gene synonyms/obsolete |
rds1 |
Gene product |
involved in stress
response; adenine-repressible gene; regulated by glucose,
ammonium, phosphate, carbon dioxide and temperature; no
apparent orthologs |
Entry clone |
Cloned |
ORF length (unspliced) |
1209 |
ORF length (spliced) |
|
Entry clone length |
1209 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
163A:G / 166T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC343.12.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTTCAAGCTCTTACTGC |
Rev primer name |
SPAC343.12.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATCCGGACTCGTAAACAAGA |
Amino acid length |
402 |
Molecular weight |
43.8 |
Isoelectric point (calc.) |
4.3 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal
|