| Gene name |
SPBC1105.05 |
| Gene ID |
19/E04 |
| Gene synonyms/obsolete |
exg1 |
| Gene product |
glucan
1,3-beta-glucosidase I/II precursor; exo-beta-1,3-glucanase
(putative) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1224 |
| ORF length (spliced) |
|
| Entry clone length |
1224 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
830T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC1105.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTCTCTTTTACATCGGT |
| Rev primer name |
SPBC1105.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACCGCAGTAAGAGCTATAT |
| Amino acid length |
407 |
| Molecular weight |
45.5 |
| Isoelectric point (calc.) |
3.9 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Confocal
|