| Gene name |
SPAC1486.06 |
| Gene ID |
19/F05 |
| Gene synonyms/obsolete |
|
| Gene product |
nicotinate
phosphoribosyltransferase; involved in nicotinate metabolism;
involved in nicotinamide metabolism |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1233 |
| ORF length (spliced) |
|
| Entry clone length |
1233 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
485G:A / 1145T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1486.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTGAACCGGCTGTTGT |
| Rev primer name |
SPAC1486.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGCTATAGGGAGGCATAAT |
| Amino acid length |
410 |
| Molecular weight |
46.6 |
| Isoelectric point (calc.) |
6.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus;
mitochondrion |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal
|