| Gene name |
SPCC18B5.10c |
| Gene ID |
19/G10 |
| Gene synonyms/obsolete |
|
| Gene product |
conserved
hypothetical; WD repeat protein; no apparent Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1240 |
| ORF length (spliced) |
930 |
| Entry clone length |
1240 |
| No. of intron |
6 |
| Sequence status |
Finished |
| Sequence results |
275T:C / 1126G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC18B5.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTGTGCTTCAGTTACAGA |
| Rev primer name |
SPCC18B5.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAGCCCAAATATCTTAAGA |
| Amino acid length |
309 |
| Molecular weight |
35 |
| Isoelectric point (calc.) |
5.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
DeltaVision |