| Gene name |
SPCC645.01 |
| Gene ID |
19/H11 |
| Gene synonyms/obsolete |
cig1; SPCC4E9.02 |
| Gene product |
B-type cyclin; G1/S
transition |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1248 |
| ORF length (spliced) |
|
| Entry clone length |
1248 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
443C:A / 814A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC645.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACGTTTCGACTCAAAC |
| Rev primer name |
SPCC645.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAATCACACTTAGTACCCAG |
| Amino acid length |
415 |
| Molecular weight |
47.8 |
| Isoelectric point (calc.) |
5.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
26 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVGLSALLI |
| Localization (YFP) |
nucleus; bright
nuclear dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
DeltaVision |