Gene name |
SPCC1223.12c |
Gene ID |
20/A01 |
Gene synonyms/obsolete |
meu10 |
Gene product |
involved in cell wall
biosynthesis; meiotic expression upregulated; involved in
spore wall assembly (required); similar to Sp SPAC1705.03c;
GPI anchored protein (pers. comm. Birgit Eisenhaber) |
Entry clone |
Cloned |
ORF length (unspliced) |
1251 |
ORF length (spliced) |
|
Entry clone length |
1251 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
659T:C / 797A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC1223.12.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGCTTGTCTTCACGCTT |
Rev primer name |
SPCC1223.12.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAGCAAGTGCGCAAAGCCA |
Amino acid length |
416 |
Molecular weight |
45.5 |
Isoelectric point (calc.) |
8.1 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRDVKGGLNI |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |