Gene name |
SPACUNK12.02c |
Gene ID |
20/A06 |
Gene synonyms/obsolete |
cmk1 |
Gene product |
serine/threonine
protein kinase; calmodulin kinase I homolog; CaM-dependent
protein kinase; cell cycle-dependent expression; predicted
regulatory site (Thr-192) |
Entry clone |
Cloned |
ORF length (unspliced) |
1256 |
ORF length (spliced) |
1008 |
Entry clone length |
1256 |
No. of intron |
4 |
Sequence status |
Finished |
Sequence results |
37A:G / 246A:G /
465T:C / 1234A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPACUNK12.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAGCAAACATACAAACC |
Rev primer name |
SPACUNK12.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATGCTTATTCTCAAGCTTT |
Amino acid length |
335 |
Molecular weight |
38.1 |
Isoelectric point (calc.) |
9.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol=nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |