| Gene name |
SPBC19G7.15 |
| Gene ID |
20/A07 |
| Gene synonyms/obsolete |
|
| Gene product |
nucleoporin; nuclear
pore complex |
| Entry clone |
Cloned in 2006
trial |
| ORF length (unspliced) |
1256 |
| ORF length (spliced) |
1212 |
| Entry clone length |
1256 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC19G7.15.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCATTTTCTTTTGGTAT |
| Rev primer name |
SPBC19G7.15.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTTTGTGATTGAGGAACG |
| Amino acid length |
403 |
| Molecular weight |
44.4 |
| Isoelectric point (calc.) |
10 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSERILRLAI |
| Localization (YFP) |
nuclear envelope;
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |