| Gene name |
SPBC29A3.03c |
| Gene ID |
20/A11 |
| Gene synonyms/obsolete |
|
| Gene product |
zinc finger protein;
zf-C3HC4 type (RING finger); ubiquitin ligase (E3); LisH
domain-suggested to function in microtubule dynamics; CLTH
domain (inferred from context); involved in catabolite
degradation; involved in vacuolar import and degradation |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1257 |
| ORF length (spliced) |
1197 |
| Entry clone length |
1257 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC29A3.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATATCGACGAATGGCA |
| Rev primer name |
SPBC29A3.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAAGTAGACACGAATAGCG |
| Amino acid length |
398 |
| Molecular weight |
45.6 |
| Isoelectric point (calc.) |
7.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGMSLESPLDI |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |