Gene name |
SPBC1289.11 |
Gene ID |
20/B01 |
Gene synonyms/obsolete |
spf38; cwf17 |
Gene product |
small nuclear
ribonucleoprotein (snRNP) U5 particle component; WD repeat
protein; complexed with Cdc5p; involved in mRNA splicing; no
apparent Sc ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
1257 |
ORF length (spliced) |
1023 |
Entry clone length |
1257 |
No. of intron |
5 |
Sequence status |
Finished |
Sequence results |
553A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC1289.11.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATAAACGAAAGGAATC |
Rev primer name |
SPBC1289.11.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATTCAATTCCCCAAGAAAT |
Amino acid length |
340 |
Molecular weight |
37.4 |
Isoelectric point (calc.) |
7.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |