Gene name |
SPCC1919.03c |
Gene ID |
20/C01 |
Gene synonyms/obsolete |
|
Gene product |
5'-amp-activated
protein kinase beta subunit; involved in the regulation of
fatty acid synthesis by the phosphorylation of acetyl-CoA
carboxylase; involved in the regulation of carbohydrate
metabolism; N-myristoylated (ISS) |
Entry clone |
Cloned |
ORF length (unspliced) |
1264 |
ORF length (spliced) |
897 |
Entry clone length |
1264 |
No. of intron |
4 |
Sequence status |
Finished |
Sequence results |
1080T:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC1919.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGAAATGTTCAATCTCA |
Rev primer name |
SPCC1919.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGACATCAAAATTTTTAAAC |
Amino acid length |
298 |
Molecular weight |
32.9 |
Isoelectric point (calc.) |
6.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
ambiguous structure;
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |