| Gene name |
SPAC1705.03c |
| Gene ID |
20/C02 |
| Gene synonyms/obsolete |
SPAC1F2.01;
SPAC23H4.19 |
| Gene product |
involved in cell wall
biosynthesis; similar to Sp SPCC1223.12c; GPI anchored protein
(pers. comm. Birgit Eisenhaber) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1266 |
| ORF length (spliced) |
|
| Entry clone length |
1266 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
105T:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1705.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTGTTCAAATCATTCGC |
| Rev primer name |
SPAC1705.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACATAGCAAGAGCAGCAACC |
| Amino acid length |
421 |
| Molecular weight |
43.3 |
| Isoelectric point (calc.) |
3.6 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |