| Gene name |
SPBC6B1.04 |
| Gene ID |
20/C06 |
| Gene synonyms/obsolete |
mde4 |
| Gene product |
no apparent orthologs;
involved in meiosis (implicated); involved in sporulation
(implicated); Mei4p-dependent expression |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1266 |
| ORF length (spliced) |
|
| Entry clone length |
1266 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC6B1.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTACCATTTCCACGTC |
| Rev primer name |
SPBC6B1.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTTTTCATTGTAAATCCT |
| Amino acid length |
421 |
| Molecular weight |
47.6 |
| Isoelectric point (calc.) |
10.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFYLSKALNL |
| Localization (YFP) |
SPB?; spindle
microtubules |
| Comments for localization |
not at anaphase
SPBs |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |