| Gene name |
SPAC3A12.11c |
| Gene ID |
20/C12 |
| Gene synonyms/obsolete |
cwf2; prp3 |
| Gene product |
involved in mRNA
splicing; zinc finger protein; zf-CCCH type; RNA-binding
protein; rrm RNA recognition motif; RNP-containing protein;
40S snRNP-containing complex; nineteen complex (Ntc);
complexed with Cdc5p; interacts physically with Cdc5p;
interacts physically with Cwf8p; mutant (prp3-1) accumulates
unspliced mRNAs |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1270 |
| ORF length (spliced) |
1167 |
| Entry clone length |
1270 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
676T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC3A12.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCAGAAAATGGGTTAGA |
| Rev primer name |
SPAC3A12.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTCTTCATCACTATCGTAA |
| Amino acid length |
388 |
| Molecular weight |
44.2 |
| Isoelectric point (calc.) |
5.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
37 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |