Gene name |
SPBC1198.01 |
Gene ID |
20/D04 |
Gene synonyms/obsolete |
|
Gene product |
glutathione-dependent
formaldehyde dehydrogenase; no apparent Sc ortholog; conserved
in microbes |
Entry clone |
Cloned |
ORF length (unspliced) |
1272 |
ORF length (spliced) |
|
Entry clone length |
1272 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
932A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC1198.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAATATCTAACCAATTT |
Rev primer name |
SPBC1198.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTCCGTCATATCACAATAT |
Amino acid length |
423 |
Molecular weight |
46.4 |
Isoelectric point (calc.) |
5.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
Golgi |
Comments for localization |
accumulated Golgi by
over expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |