Gene name |
SPBC4F6.02c |
Gene ID |
20/F10 |
Gene synonyms/obsolete |
SPBC3E7.15c |
Gene product |
LAG1 domain; lipid
sensing domain; involved in ceramide synthesis |
Entry clone |
Cloned |
ORF length (unspliced) |
1336 |
ORF length (spliced) |
1155 |
Entry clone length |
1336 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
640T:C / 1080G:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC4F6.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGTAATAATACCTCGAG |
Rev primer name |
SPBC4F6.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATCATTCTTTTTAGCGGAC |
Amino acid length |
384 |
Molecular weight |
45.3 |
Isoelectric point (calc.) |
9.5 |
Signal SEQ |
|
No. of transmembrane domain |
7 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LILLTALQL |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
DeltaVision |