Gene name |
SPCC18.13 |
Gene ID |
20/G02 |
Gene synonyms/obsolete |
|
Gene product |
conserved
hypothetical; WD repeat protein |
Entry clone |
Cloned |
ORF length (unspliced) |
1339 |
ORF length (spliced) |
1266 |
Entry clone length |
1339 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
711T:deletion /
712T:deletion / 904A:G / 962T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC18.13.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTGAACAGCGAGTTTT |
Rev primer name |
SPCC18.13.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATTATCTTTAGATTCAACG |
Amino acid length |
421 |
Molecular weight |
47.4 |
Isoelectric point (calc.) |
5.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRSAFSTYLSL |
Localization (YFP) |
cytosol=nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |