Gene name |
SPAC30C2.04 |
Gene ID |
21/A02 |
Gene synonyms/obsolete |
|
Gene product |
cofactor for
methionyl-and glutamyl-tRNA synthetases; G4 quadruplex nucleic
acid binding protein |
Entry clone |
Cloned in 2006
trial |
ORF length (unspliced) |
1353 |
ORF length (spliced) |
|
Entry clone length |
1353 |
No. of intron |
0 |
Sequence status |
Partially
sequenced |
Sequence results |
100% match in both
ends |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC30C2.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTTTTCTCTGGGCAAA |
Rev primer name |
SPAC30C2.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACTTAATGTGCCATTGACA |
Amino acid length |
450 |
Molecular weight |
50.6 |
Isoelectric point (calc.) |
9.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
216 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKFISKYLQI |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
DeltaVision |