| Gene name |
SPAC821.11 |
| Gene ID |
21/A06 |
| Gene synonyms/obsolete |
pro1 |
| Gene product |
gamma-glutamyl
phosphate reductase |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1356 |
| ORF length (spliced) |
|
| Entry clone length |
1356 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
400A:G / 635A:G /
657T:C / 912T:C / 1311T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC821.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTCTTGAAGAGAATGT |
| Rev primer name |
SPAC821.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTTTTCGAAACCTGAGAA |
| Amino acid length |
451 |
| Molecular weight |
48.7 |
| Isoelectric point (calc.) |
6.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDKIVEELRI/LSSSMVKRLDL |
| Localization (YFP) |
cytosol>nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
cytosol=nucleus |
| Microscope used for
observation |
DeltaVision |