| Gene name |
SPAC23C11.11 |
| Gene ID |
21/B12 |
| Gene synonyms/obsolete |
cka1; orb5 |
| Gene product |
serine/threonine
protein kinase; casein kinase II (alpha subunit); involved in
cell growth regulation; involved in cell polarity
(maintenance) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1371 |
| ORF length (spliced) |
999 |
| Entry clone length |
1371 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC23C11.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAACCAGACTGAAGCGGC |
| Rev primer name |
SPAC23C11.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTGAGTACTTGAAAGTAC |
| Amino acid length |
332 |
| Molecular weight |
39.5 |
| Isoelectric point (calc.) |
8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleolus>nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle
(nucleolus>nucleus>cytosol) |
| Microscope used for
observation |
DeltaVision |