Gene name |
SPCC1393.06c |
Gene ID |
21/D08 |
Gene synonyms/obsolete |
|
Gene product |
involved in RNA
processing and modification (implicated) |
Entry clone |
Cloned |
ORF length (unspliced) |
1383 |
ORF length (spliced) |
1227 |
Entry clone length |
1383 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC1393.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGTAAATCAAAGAAAGC |
Rev primer name |
SPCC1393.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTTACCCGGGTTCTCCAAT |
Amino acid length |
408 |
Molecular weight |
46.2 |
Isoelectric point (calc.) |
9.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLLKLTSPLIL |
Localization (YFP) |
SPB; nucleus; nuclear
dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |