| Gene name |
SPAC821.02c |
| Gene ID |
21/D10 |
| Gene synonyms/obsolete |
csn3;
SPAC222.16c |
| Gene product |
COP9/signalosome
complex (subunit 3); no apparent Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1386 |
| ORF length (spliced) |
1005 |
| Entry clone length |
1386 |
| No. of intron |
6 |
| Sequence status |
Finished |
| Sequence results |
214C:A / 253G:A /
473A:G / 626T:C / 652T:C / 732G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC821.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAATTTCAAGGAACTTT |
| Rev primer name |
SPAC821.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACGCGTTGAGCTTTTTTGCC |
| Amino acid length |
334 |
| Molecular weight |
38.5 |
| Isoelectric point (calc.) |
6.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEYIAKQLAI |
| Localization (YFP) |
cytosol=nucleus; spore
membrane |
| Comments for localization |
dots in nucleus during
horse-tail period |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |