| Gene name |
SPAC637.12c |
| Gene ID |
21/E06 |
| Gene synonyms/obsolete |
mst1 |
| Gene product |
MYST-family HAT (pers.
comm. S. Forsburg); histone acetyltransferase; MOZ/SAS domain;
chromodomain protein; involved in transcriptional
silencing |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1392 |
| ORF length (spliced) |
|
| Entry clone length |
1392 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
414T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC637.12.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGAATGATGTTGATGA |
| Rev primer name |
SPAC637.12.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACCATCCAAATCGTAGTTGG |
| Amino acid length |
463 |
| Molecular weight |
54.3 |
| Isoelectric point (calc.) |
7.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
432/436 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |