| Gene name |
SPBC36.12c |
| Gene ID |
22/A07 |
| Gene synonyms/obsolete |
git7;
SPBC713.01c |
| Gene product |
glucose insensitive
transcription; cyclic AMP (cAMP) signaling pathway component;
essential; requirement appears to be due to roles in septation
and cell wall integrity; involved in adenylate cyclase
activation (required); mutants are sensitive to benomyl; CS
domain; SGS domain; TPR repeat protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1239 |
| ORF length (spliced) |
1140 |
| Entry clone length |
1239 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
ORF prediction was
changed. |
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC36.12.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGTGTAGATCTTTCTGA |
| Rev primer name |
SPBC36.12.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAATTTTTTTGGTTCCATT |
| Amino acid length |
379 |
| Molecular weight |
42.9 |
| Isoelectric point (calc.) |
5.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |