| Gene name |
SPAC8F11.10c |
| Gene ID |
22/B02 |
| Gene synonyms/obsolete |
SPACUNK4.18 |
| Gene product |
pyruvyltransferase
(pers. comm. Robert Trimble); involved in cell wall
biosynthesis; deletion mutant galactomannans deficient for
pyruvylated galactose-beta-1,3-galactose-alpha-1,2-pyruvate
(Pv) (pers. comm. Robert Trimble); no apparent Sc
ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1206 |
| ORF length (spliced) |
|
| Entry clone length |
1206 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
Primer's names are
different from the clone name used now. |
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPACUNK4.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTCGCAAACATTAATAT |
| Rev primer name |
SPACUNK4.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAAGTAGCCGGCCTCATTC |
| Amino acid length |
401 |
| Molecular weight |
44.8 |
| Isoelectric point (calc.) |
5.1 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLAAVSCTLFI |
| Localization (YFP) |
cytoplasmic dots;
Golgi? |
| Comments for localization |
ER-Golgi? |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |