| Gene name |
SPBC19G7.16 |
| Gene ID |
22/C10 |
| Gene synonyms/obsolete |
|
| Gene product |
conserved hypothetical
protein; predicted coiled-coil region |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1287 |
| ORF length (spliced) |
|
| Entry clone length |
1287 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
308A:G / 1064A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC19G7.16.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCAGAAGAAGAAAAGGC |
| Rev primer name |
SPBC19G7.16.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAGTCCACGACCTTCAATA |
| Amino acid length |
428 |
| Molecular weight |
49.1 |
| Isoelectric point (calc.) |
5.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LMDILTKLPI |
| Localization (YFP) |
nucleolus>nucleus;
spindle microtubules |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleus) |
| Microscope used for
observation |
Confocal |