Gene name |
SPAC4G9.17c |
Gene ID |
22/D05 |
Gene synonyms/obsolete |
|
Gene product |
mitochondrial
ribosomal protein S5 |
Entry clone |
Cloned |
ORF length (unspliced) |
1291 |
ORF length (spliced) |
1164 |
Entry clone length |
1291 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
207A:G / 580T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC4G9.17.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTACGCTCATTTTCACA |
Rev primer name |
SPAC4G9.17.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATGTTTGTTTGTAATACTCG |
Amino acid length |
387 |
Molecular weight |
43.9 |
Isoelectric point (calc.) |
9.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRSFSHFLQI |
Localization (YFP) |
mitochondrion |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |