| Gene name |
SPBC1734.04 |
| Gene ID |
22/E01 |
| Gene synonyms/obsolete |
SPBC337.20 |
| Gene product |
alpha-1,6-mannosyltransferase complex subunit
predicted; belongs to the ANP1/MMN9/VAN1 family; similar to
S. cerevisiae YEL036C and YML115C and YPL050C |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1293 |
| ORF length (spliced) |
|
| Entry clone length |
1293 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1221T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC1734.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAAGCAAATAGAGACTT |
| Rev primer name |
SPBC1734.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCAACATGATCGTCTGCA |
| Amino acid length |
430 |
| Molecular weight |
48.9 |
| Isoelectric point (calc.) |
4.8 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
ER; Golgi |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |