| Gene name |
SPCC1795.02c |
| Gene ID |
22/E03 |
| Gene synonyms/obsolete |
SPCC895.01 |
| Gene product |
CaCA proton/calcium
exchanger |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1295 |
| ORF length (spliced) |
1239 |
| Entry clone length |
1295 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
1228T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC1795.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATTGAGAGATTAAAGAT |
| Rev primer name |
SPCC1795.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTGAGGGTAGTAGAAAAAG |
| Amino acid length |
412 |
| Molecular weight |
45.1 |
| Isoelectric point (calc.) |
5.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
11 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLGSILSNLLL/LRSSIAMLAI/LEGVQLLAL |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |