| Gene name |
SPAC3G9.07c |
| Gene ID |
22/F12 |
| Gene synonyms/obsolete |
phd1; hda1 |
| Gene product |
transcriptional
regulator; histone deacetylase; NAD-independent histone
deacetylase activity; RPD3-like (class I); involved in
transcriptional regulation; involved in chromatin silencing;
involved in chromatin assembly/disassembly |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1305 |
| ORF length (spliced) |
|
| Entry clone length |
1305 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC3G9.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATACTCCTGAGACATC |
| Rev primer name |
SPAC3G9.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGCCTCGAACGCGAACATCC |
| Amino acid length |
434 |
| Molecular weight |
49.3 |
| Isoelectric point (calc.) |
5.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRFFPRVLYI |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
except nucleolus |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |