| Gene name |
SPBC106.04 |
| Gene ID |
22/G11 |
| Gene synonyms/obsolete |
ada1 |
| Gene product |
adenosine OR AMP
deaminase activity; involved in purine metabolism;
non-essential |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2721 |
| ORF length (spliced) |
2541 |
| Entry clone length |
2721 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
62C:T / 162A:G /
548T:C / 938A:G / 1930A:G / 2568T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC106.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTGTACGTCCTCTCTC |
| Rev primer name |
SPBC106.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCTTTCAAATCTTGGCTA |
| Amino acid length |
846 |
| Molecular weight |
97.4 |
| Isoelectric point (calc.) |
6.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
829 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LQEVFDSLKL |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |