| Gene name |
SPAC27F1.04c |
| Gene ID |
23/A09 |
| Gene synonyms/obsolete |
nuf2 |
| Gene product |
centomere compoment
(GFP); predicted coiled-coil protein; spindle pole
body-associated protein required for nuclear division;
involved in spindle pole body separation and spindle
elongation, leading to chromosome segration; involved in the
attachment of centromeres to spindle microtubules. |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1326 |
| ORF length (spliced) |
|
| Entry clone length |
1326 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC27F1.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCACGAAAACACACATT |
| Rev primer name |
SPAC27F1.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGAGTTAGAAGACCTTAAG |
| Amino acid length |
441 |
| Molecular weight |
51.9 |
| Isoelectric point (calc.) |
5.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LECIDGLGI/LHTKLNSLQL |
| Localization (YFP) |
SPB;
nucleus>=cytosol |
| Comments for localization |
nuclear dots by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |