Gene name |
SPCC569.06 |
Gene ID |
23/B10 |
Gene synonyms/obsolete |
|
Gene product |
Sp specific families;
similar to Sp SPCC61.05 and SPAC26H5.07C |
Entry clone |
Cloned |
ORF length (unspliced) |
1437 |
ORF length (spliced) |
|
Entry clone length |
1437 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
252A:T / 1069T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC569.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAACTCTTCCCATTATG |
Rev primer name |
SPCC569.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAACTTTTCTAGACTAGGG |
Amino acid length |
478 |
Molecular weight |
54.2 |
Isoelectric point (calc.) |
7.1 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
6 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFAFNDLVI |
Localization (YFP) |
ER; Golgi |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |