Gene name |
SPAC29A4.18 |
Gene ID |
23/C03 |
Gene synonyms/obsolete |
|
Gene product |
WD repeat protein;
involved in chromatin assembly/disassembly; involved in
transcriptional regulation; involved in chromatin silencing;
acetyltransferase complex; involved in histone deacetylation;
similar to Sp SPCC1672.10 |
Entry clone |
Cloned |
ORF length (unspliced) |
1443 |
ORF length (spliced) |
1296 |
Entry clone length |
1443 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
1167T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC29A4.18.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTGTATCAGCTGTTCC |
Rev primer name |
SPAC29A4.18.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACTTAAATATGCCGTAGCA |
Amino acid length |
431 |
Molecular weight |
48.4 |
Isoelectric point (calc.) |
5.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |