| Gene name |
SPAC29A4.18 |
| Gene ID |
23/C03 |
| Gene synonyms/obsolete |
|
| Gene product |
WD repeat protein;
involved in chromatin assembly/disassembly; involved in
transcriptional regulation; involved in chromatin silencing;
acetyltransferase complex; involved in histone deacetylation;
similar to Sp SPCC1672.10 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1443 |
| ORF length (spliced) |
1296 |
| Entry clone length |
1443 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
1167T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC29A4.18.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTGTATCAGCTGTTCC |
| Rev primer name |
SPAC29A4.18.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACTTAAATATGCCGTAGCA |
| Amino acid length |
431 |
| Molecular weight |
48.4 |
| Isoelectric point (calc.) |
5.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |