Gene name |
SPBC215.03c |
Gene ID |
23/C05 |
Gene synonyms/obsolete |
csn1 |
Gene product |
COP9/signalosome
complex (subunit 1); required for the removal of Ned8p from
Pcu1p; involved in DNA damage checkpoint; no apparent Sc
ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
1443 |
ORF length (spliced) |
1269 |
Entry clone length |
1443 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
180T:C / 1167T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC215.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCTTAAATCTACTAGT |
Rev primer name |
SPBC215.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGTTCTGTGAATCTTCCGCG |
Amino acid length |
422 |
Molecular weight |
48.6 |
Isoelectric point (calc.) |
4.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |